3×flag peptide (MedChemExpress)
MedChemExpress is a verified supplier 
MedChemExpress manufactures this product 
95
Structured Review
MedChemExpress
3×flag peptide
3×Flag Peptide, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 95/100, based on 43 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/3%C3%97flag+peptide/FLAG+peptide/pmc13439101-324-9-11
Average 95 stars, based on 43 article reviews
3×Flag Peptide, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 95/100, based on 43 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/3%C3%97flag+peptide/FLAG+peptide/pmc13439101-324-9-11
Average 95 stars, based on 43 article reviews
3×flag peptide - by Bioz Stars,
2026-10
95/100 stars
Images
Related Articles
Incubation:Article Title: Targeting MYC in T-Cell lymphoma via epigenetic modulation with a small-molecule inhibitor. Article Snippet: .. The beads-protein mixture was washed with 1ml wash buffer [50mM Tris HCl, 500mM NaCl, 0.1%NP40, 1mM EDTA, 1mM PMSF] five times, then incubated with Article Title: Targeting MYC in T-Cell lymphoma via epigenetic modulation with a small-molecule inhibitor Article Snippet: .. The beads-protein mixture was washed with 1 ml wash buffer [50mM Tris HCl, 500mM NaCl, 0.1%NP40, 1mM EDTA, 1mM PMSF] five times, then incubated with Purification:Article Title: Targeting MYC in T-Cell lymphoma via epigenetic modulation with a small-molecule inhibitor. Article Snippet: .. The beads-protein mixture was washed with 1ml wash buffer [50mM Tris HCl, 500mM NaCl, 0.1%NP40, 1mM EDTA, 1mM PMSF] five times, then incubated with Article Title: Dephosphorylation at Ser548 regulates hemocyanin-derived antibacterial peptides and immune defense in Penaeus vannamei Article Snippet: Cells were harvested 48 h post-transfection and lysed with RIPA buffer (Beyotime, P0013B). .. Pv HMCs-Flag proteins were purified using Anti-Flag M2 Magnetic Beads (MedChemExpress, HY-K0207) and eluted with 100 mM Article Title: Targeting MYC in T-Cell lymphoma via epigenetic modulation with a small-molecule inhibitor Article Snippet: .. The beads-protein mixture was washed with 1 ml wash buffer [50mM Tris HCl, 500mM NaCl, 0.1%NP40, 1mM EDTA, 1mM PMSF] five times, then incubated with Article Title: CRM1 inhibits NPAT condensation and histone locus body formation via a competitive occupation strategy. Article Snippet: Importins could inhibit the condensation of RNA-binding proteins, while it remains unknown whether exportins elicit a similar function.. Here, we identified that exportin CRM1 binds to the nuclear protein NPAT, which initiates and maintains the formation of the histone locus body (HLB), a membraneless nuclear body regulating histone transcription.. CRM1 drives the nuclear export of NPAT by targeting a nuclear export signal (NES) within the LisH domain. Article Title: Polyglutamine homorepeat regulates Runx2 condensation and cellular localization in a KPNA3-dependent manner. Article Snippet: Anti-FLAG M2 gel beads (Bimake, B23102) were then added and incubated on a rotary shaker at 4◦C for 2 h. M2 gel beads were harvested by centrifugation at 3,000 rpm for 1 min and washed in the HEPES buffer. .. The FLAG-tagged protein was purified by competition using Magnetic Beads:Article Title: Dephosphorylation at Ser548 regulates hemocyanin-derived antibacterial peptides and immune defense in Penaeus vannamei Article Snippet: Cells were harvested 48 h post-transfection and lysed with RIPA buffer (Beyotime, P0013B). .. Pv HMCs-Flag proteins were purified using Anti-Flag M2 Magnetic Beads (MedChemExpress, HY-K0207) and eluted with 100 mM Article Title: Caspase 5c amplifies Wnt via APC cleavage to promote intestinal homeostasis. Article Snippet: To generate APC-knockout HEK293T cells, we targeted the sequence GGATCTGTATCAAGCCGTTC using CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA) alongside recombinant Streptococcus pyogenes Cas9 nuclease, all purchased from Integrated DNA Technologies (IDT). .. Flag-tagged truncated APC was immunopurified from HEK293T lysates using Anti-Flag M2 Magnetic Beads (Sigma-Aldrich, M8823) and eluted with |